View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_high_87 (Length: 249)
Name: NF20816_high_87
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_high_87 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 33907889 - 33908123
Alignment:
| Q |
1 |
tgaaatgttcaccttctgatggttgctatttatccatctgttgtcaaacaatcatcatcgaatcttatgtcaatctgacatgattctatggtatatttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33907889 |
tgaaatgttcaccttctgatggttgctatttgtccatctgttgtcaaacaatcgtcatcgaatcttatgtcaatctgacatgattctatggtatatttga |
33907988 |
T |
|
| Q |
101 |
aaaacctaggccaagttaattaccctggccatatgacatgtctgccaacgagttaataagactcggcaacattaattctaatggtaggcctaataggtca |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33907989 |
aaaacctaggccaagtta----ccctggccatatgacatgtctgccaacgagttaataagactcggcaacattaattctaatggtaggcctaataggtca |
33908084 |
T |
|
| Q |
201 |
gcaactactgggcgtgactacatgaaagttatgtctgtg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33908085 |
gcaactactgggcgtgactacatgaaagttatgtctgtg |
33908123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University