View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_101 (Length: 236)
Name: NF20816_low_101
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_101 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 10817099 - 10816879
Alignment:
| Q |
16 |
acatcaacactatattgaccatcaggaataaatgccttactttgaaatgcttacactgaactagtgaaaacctttagaactggaatttaacaatcttcct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10817099 |
acatcaacactatattgaccatcaggaataaatgccttactttgaaatgcttacactgaactagtgaaaacctttagaactggaatttaacaatcttcct |
10817000 |
T |
|
| Q |
116 |
caccttgttttccccgaccattactctcaggggagcgaatgcccatggccaagaggtgcacccgttgaaccaaattagttcacaccctccgtaggccttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10816999 |
caccttgttttccccgaccattactctcaggggagcgattgcccatggccaagaggtgcacccgttgaaccaaattagttcacaccctccgtaggccttt |
10816900 |
T |
|
| Q |
216 |
agatcatcttcaaataggccc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10816899 |
agatcatcttcaaataggccc |
10816879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University