View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20816_low_102 (Length: 236)

Name: NF20816_low_102
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20816_low_102
NF20816_low_102
[»] chr7 (1 HSPs)
chr7 (1-220)||(27638633-27638855)


Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 27638855 - 27638633
Alignment:
1 aggtggtgatggggcagtgacaatagtgtttaatttgttgtgtaacaatttagaattacaacactcctttgttatgatgtattggtgtatatggaaaaga 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27638855 aggtggtgatggggcagcgacaatagtgtttaatttgttgtgtaacaatttagaattacaacactcctttgttatgatgtattggtgtatatggaaaaga 27638756  T
101 aggaaggggaaggtgtgggagaattctgcaaaaccagatcagattttagtattgcacacgttgagcattt---tgcacaactgatagcaggtagcaaaga 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||| ||||||||||| |||||| ||||    
27638755 aggaaggggaaggtgtgggagaattctgcaaaaccagatcagattttagtattgcacacgttgagcattttgatgctcaactgatagcgggtagcgaaga 27638656  T
198 cgtaacataatctatcaaaatat 220  Q
    ||| |||||||||||||||||||    
27638655 cgtgacataatctatcaaaatat 27638633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University