View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_102 (Length: 236)
Name: NF20816_low_102
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_102 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 27638855 - 27638633
Alignment:
| Q |
1 |
aggtggtgatggggcagtgacaatagtgtttaatttgttgtgtaacaatttagaattacaacactcctttgttatgatgtattggtgtatatggaaaaga |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27638855 |
aggtggtgatggggcagcgacaatagtgtttaatttgttgtgtaacaatttagaattacaacactcctttgttatgatgtattggtgtatatggaaaaga |
27638756 |
T |
 |
| Q |
101 |
aggaaggggaaggtgtgggagaattctgcaaaaccagatcagattttagtattgcacacgttgagcattt---tgcacaactgatagcaggtagcaaaga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||| |||| |
|
|
| T |
27638755 |
aggaaggggaaggtgtgggagaattctgcaaaaccagatcagattttagtattgcacacgttgagcattttgatgctcaactgatagcgggtagcgaaga |
27638656 |
T |
 |
| Q |
198 |
cgtaacataatctatcaaaatat |
220 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
27638655 |
cgtgacataatctatcaaaatat |
27638633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University