View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_108 (Length: 215)
Name: NF20816_low_108
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_108 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 28 - 200
Target Start/End: Complemental strand, 6482922 - 6482741
Alignment:
| Q |
28 |
aactttcttttcgtgaccatatcgtgatcaaattcttttagatatatagcattactcagannnnnnnnn---------gggtcatgttctattgtaaatt |
118 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6482922 |
aactttcttttcgcgaccatatcgtgatcaaattcttctagatatatagcattactcagaatttttttttttttttttgggtcatgttctattgtaaatt |
6482823 |
T |
|
| Q |
119 |
gatggtgtacagattgaatttcttgaaacatgcgttcttcatttgccannnnnnnncttcctgttactattttactgatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
6482822 |
gatggtgtacagattgaatttcttgaaacatgcgttcttcatttgccattttttttcttcccgttactattttactgatttt |
6482741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 84
Target Start/End: Complemental strand, 33427050 - 33426987
Alignment:
| Q |
21 |
attggccaactttcttttcgtgaccatatcgtgatcaaattctttt-agatatatagcattactc |
84 |
Q |
| |
|
|||||| ||||| ||||||||||||| |||||| | |||||||||| |||||||||||| ||||| |
|
|
| T |
33427050 |
attggctaacttgcttttcgtgaccacatcgtgct-aaattctttttagatatatagcaatactc |
33426987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University