View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_117 (Length: 202)
Name: NF20816_low_117
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_117 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 42534298 - 42534349
Alignment:
| Q |
29 |
tacttgacaaaaaatattgacctggtcagtgaagctaagtcttatgaacctc |
80 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
42534298 |
tacttgacaaaaaatatggacctggtcagtgaagctaagtcttaggaacctc |
42534349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 143 - 185
Target Start/End: Original strand, 42534815 - 42534857
Alignment:
| Q |
143 |
gataataagaagcaccagttgagtagtactatttcatttgttt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42534815 |
gataataagaagcaccagttgagtagtactatttcatttgttt |
42534857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University