View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_37 (Length: 412)
Name: NF20816_low_37
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_37 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 13 - 395
Target Start/End: Complemental strand, 29468 - 29085
Alignment:
| Q |
13 |
aaaatatcatgtcagccttaatcggaaaatatgtgattaggttttggtgaggaaaccccatagccaagggaaggttaaatgaaggctagaatagccaatc |
112 |
Q |
| |
|
|||||||||| | |||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29468 |
aaaatatcatcttagccttaatcagtaaatatgtgattaggttttggtgaggaaaccccatagccgagggaaggttaaatgaaggctagaatagccaatc |
29369 |
T |
 |
| Q |
113 |
aaggaagaacatattctttctcaagtctagtgactaagaacatgggtttcaaaaatcccagattgagttaaagcgcaatatgtttatagcatcactaacc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29368 |
aaggaagaacatattctttctcaagtctagtgactaagaacatgggtttcaaaaatcctagattgagttaaagcgcaatatgtttatagcatcactaacc |
29269 |
T |
 |
| Q |
213 |
aagaagagcaatg--agaggaggcacgtttgtggggagttgcgtaccaaagattttgtcaacgaatcatgcttgaaagaggagactaaaagccaaactta |
310 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29268 |
aagaagagcaatgagagaggaggcacgtttgtggggagttgcgtaccaaagattttgtcaacgaatcatgc-ggaaagaggagactaaaagccaaacttg |
29170 |
T |
 |
| Q |
311 |
gggcaccacaatcccctcaataagggaaaccaacacactacttatgaaattagatgagtaggggctgaacaccgtaggccacatc |
395 |
Q |
| |
|
|| |||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29169 |
aggtgccacaatcccctcaatgagggaaaccaacacactacttgtgaaattagatgagtagaggctgaacaccgtaggccacatc |
29085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University