View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_42 (Length: 393)
Name: NF20816_low_42
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 18 - 155
Target Start/End: Complemental strand, 5752593 - 5752456
Alignment:
| Q |
18 |
gcaccaaattaggtggcaacctttcccttctataagtgtcaaaatatgcaagactagcatacatacctgggatgctgatacctgaattgacagcaaggga |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
5752593 |
gcaccaaattagctggcaacctttcccttctataagagtcaaaatatgcaagactagcagacatacccgggaggctgatacctgaattgacagcaaggga |
5752494 |
T |
 |
| Q |
118 |
aacaactctcctccatgcggtttggcattcaattattt |
155 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5752493 |
aacaactctcctccatgcggtttggcgttcaattattt |
5752456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 231 - 375
Target Start/End: Complemental strand, 5752355 - 5752211
Alignment:
| Q |
231 |
tcctttccaaatacgggcaagttcacccaatgccaaatcccatcccttttcagtgctctttgcactgatcagattcatcccttatgcgtaaccacagatc |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||||||||||||||| |||||||| ||| ||| |
|
|
| T |
5752355 |
tcctttccaaatacgggcaagttcacccaattccaaatcccaacccttttcagcactctttgcacggatcagattcatcccttgtgcgtaactacaaatc |
5752256 |
T |
 |
| Q |
331 |
ttggctgcgtaaagagccttcctaacatcatcaatcaactgcttc |
375 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5752255 |
ttggctgcataaagagccttcctaacatcatcaatcaactgcttc |
5752211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 223
Target Start/End: Complemental strand, 5752452 - 5752399
Alignment:
| Q |
171 |
ttgcgaactttggatccacaagaaggtttgtaagattaggg-ttctgtcgtacg |
223 |
Q |
| |
|
||||||||| |||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
5752452 |
ttgcgaactctggatccacaagaaggttagcgagattagggtttctgtcgtacg |
5752399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University