View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20816_low_49 (Length: 373)

Name: NF20816_low_49
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20816_low_49
NF20816_low_49
[»] chr8 (2 HSPs)
chr8 (302-356)||(32679764-32679818)
chr8 (52-90)||(32679510-32679548)


Alignment Details
Target: chr8 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 32679764 - 32679818
Alignment:
302 tatgaataatgatagtaacaaaaatggacagtttataaagagaagaatcgcatat 356  Q
    |||||||||| || ||||||||||||||||||||||||||||| ||||| |||||    
32679764 tatgaataataattgtaacaaaaatggacagtttataaagagaggaatcacatat 32679818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 52 - 90
Target Start/End: Original strand, 32679510 - 32679548
Alignment:
52 catattctaacttttttaaatcaatttgtataacattta 90  Q
    ||||||||||||||||| |||||||||||||||||||||    
32679510 catattctaacttttttcaatcaatttgtataacattta 32679548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University