View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_51 (Length: 361)
Name: NF20816_low_51
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 5e-41; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 225 - 347
Target Start/End: Original strand, 49580476 - 49580610
Alignment:
| Q |
225 |
ttgtaaattagtaaactctttctctactcagcctt------------gggtccaaaaaacctttatcctcttatttttctatgaaacaaacaaagaatct |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49580476 |
ttgtaaattagtaaactctttctctactcagccttcatcctcctattgggtccaaaaaacctttatcctcttatttttctatgaaacaaactaagaatct |
49580575 |
T |
 |
| Q |
313 |
attaacatttcgtcaaaaacagttttggtattatt |
347 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49580576 |
attaacatttcgtcaaaaacacttttggtattatt |
49580610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 101 - 146
Target Start/End: Original strand, 49580419 - 49580464
Alignment:
| Q |
101 |
aatatatgcgtggtttctttaagaaataatattatgatacatccaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49580419 |
aatatatgcgtggtttctttaagaaataatattatgatacatccaa |
49580464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 63 - 106
Target Start/End: Original strand, 49579903 - 49579946
Alignment:
| Q |
63 |
tgttgtgtaaaatatgtctaatcatatctcacgatttgaatata |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49579903 |
tgttgtgtaaaatatgtctaatcatatctcacgatttaaatata |
49579946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University