View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_65 (Length: 310)
Name: NF20816_low_65
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 7 - 293
Target Start/End: Complemental strand, 46618455 - 46618158
Alignment:
| Q |
7 |
acatgattcttatgtacactcacatgcatagtaaggaatttaacttcnnnnnnnnnctctctaaagtgaaggatatcaaggaagattcacatgatttaat |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618455 |
acatgtttcttatgtacactcacatgcatagtaaggaatttaacct-tttttttctctctctaaagtgaaggatatcaaggaagattcacatgatttaat |
46618357 |
T |
 |
| Q |
107 |
tgtgttttgatttaatattgtttctataaccatttatgatgagttatgaggtcattctgcatacaacaatgtgggctataagaatcctgttaaaattact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618356 |
tgtgttttgatttaatattgtttctataaccatttatgatgagttatgaggtcattctgcatacaacaatgtgggctataagaatcctgttaaaattact |
46618257 |
T |
 |
| Q |
207 |
gtta------------aaatccacgtgatatccattgaaattcatattttatttttatcaattttactttctaacctggctctggcttacattaatatt |
293 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46618256 |
gttaaaattactgttaaaatccacgtgatatccattgaaattcatattttatttttatcaattttactttctaacctggctctggcttacagtaatatt |
46618158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University