View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_70 (Length: 294)
Name: NF20816_low_70
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 19 - 279
Target Start/End: Complemental strand, 34776680 - 34776420
Alignment:
| Q |
19 |
tattactagttacgtccatgttatccttattagcaaaagttatgtaacacagacacttcagattgaaggtaatgtatcctacacattttaatgtctaaca |
118 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||| || ||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34776680 |
tattactagttactaccattttatccttattagcaaaagttatgtagcagagacacttcggattgaaagtaatgtatcctacacattttaatgtctaaca |
34776581 |
T |
|
| Q |
119 |
ttatctcaacatggacacatgttaataaattgaaacaatttcattgactaaatttaattctggtgtctgtgtcattgtcaatattgtatccggtgtgtgc |
218 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34776580 |
ttatctcaacacggacacatgttaataaattgaaacaatttcattgactaaatttaattctggtgtctgtgtcattgtcaatattgtgtccggtgtgtgc |
34776481 |
T |
|
| Q |
219 |
agtgtcagtgtctgtgcttcatagaccaaaattaaaatagtaacaattgttgaacatgcat |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34776480 |
agtgtcagtgtctgtgcttcatagaccaaaattgaaatagtaacaattgttgaacatgcat |
34776420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University