View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_78 (Length: 270)
Name: NF20816_low_78
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_78 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0041 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 100765 - 101034
Alignment:
| Q |
1 |
tcgagattatgaaaattaaattggatcatattattctcccttgctaaccttttggacaaaatttgtcacgcgataaaatcttatcaataattgttgatca |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
100765 |
tcgagattaagaaaattaaattggatcatattactctcccttgctaaccttttggacaaaatttgccacgcaataaaatcttatcaataattgttgatca |
100864 |
T |
|
| Q |
101 |
tcgatcatttgaactctataaattgtgtatgtataatgcagcggtaagaaagattaagacaaattagttaaaagtatatgtgaatttagattatttatcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
100865 |
tcgatcatttgaactctataaattgtgtatgtataatgcagcggtaagaaagattaagacaaattagttaagagtatatgtgaatttagattatttatcg |
100964 |
T |
|
| Q |
201 |
ttagagattccacacatttatcattggatcgagatccaacttctccaactttgagctcaatagatcaact |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
100965 |
ttagagattccacacatttatcattggatcgagatccaacttctccaactttgagctcaatagatcaact |
101034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 41122384 - 41122115
Alignment:
| Q |
1 |
tcgagattatgaaaattaaattggatcatattattctcccttgctaaccttttggacaaaatttgtcacgcgataaaatcttatcaataattgttgatca |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
41122384 |
tcgagattaagaaaattaaattggatcatattactctcccttgctaaccttttggacaaaatttgccacgcaataaaatcttatcaataattgttgatca |
41122285 |
T |
|
| Q |
101 |
tcgatcatttgaactctataaattgtgtatgtataatgcagcggtaagaaagattaagacaaattagttaaaagtatatgtgaatttagattatttatcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41122284 |
tcgatcatttgaactctataaattgtgtatgtataatgcagcggtaagaaagattaagacaaattagttaagagtatatgtgaatttagattatttatcg |
41122185 |
T |
|
| Q |
201 |
ttagagattccacacatttatcattggatcgagatccaacttctccaactttgagctcaatagatcaact |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41122184 |
ttagagattccacacatttatcattggatcgagatccaacttctccaactttgagctcaatagatcaact |
41122115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University