View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_79 (Length: 265)
Name: NF20816_low_79
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_79 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 44515787 - 44515685
Alignment:
| Q |
1 |
cactgaaaattcaagt--tcatatcgcctagacagccctcgaattcagacaccaattaaagacataaattaaaagttatatttaa-ggtttaccttgtct |
97 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44515787 |
cactgaaaattcaagtcttcatatcacctagacaaccctcggattcagacaccaattaaagacataaattaaaagttatatttaatggtttaccttgtct |
44515688 |
T |
|
| Q |
98 |
tcc |
100 |
Q |
| |
|
||| |
|
|
| T |
44515687 |
tcc |
44515685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University