View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20816_low_95 (Length: 240)
Name: NF20816_low_95
Description: NF20816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20816_low_95 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 114892 - 114659
Alignment:
| Q |
1 |
atttaggttcatttttaattttataataacacaacaaacaaatatcttttctgaaaacataaatttcataagctcaaaaagttgaaatagcaacataaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
114892 |
atttaggttcatttttaattttataataacacaacaaacaaatatcttttctgaaaacataaatttcataagctcaaaaagttgaaatagcaacataaaa |
114793 |
T |
|
| Q |
101 |
agaaaacataatttgcatctctctagtattagagacaccaagc---aagcataa------agacgtacgtaccttttgcctcgtttggaatgatcagatc |
191 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||| ||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
114792 |
agaaaacataatttgtatctctctagtattagagacaccaagcataaagactaatttcatatacgtacgtaccttttgcctcgtttggaatgatcagatc |
114693 |
T |
|
| Q |
192 |
tcgaatgatgttgttgtagaaaggagggttgtga |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
114692 |
tcgaatgatgttgttgtagaaaggagggttgtga |
114659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University