View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20817_high_22 (Length: 333)
Name: NF20817_high_22
Description: NF20817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20817_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 37764962 - 37764656
Alignment:
| Q |
1 |
atcttcaaactgcacttgattcatcccctatagagagaggcctcataaaacattgtcacctttgtgtgcaccataagtacacagtgcacagtgcattcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37764962 |
atcttcaaactgcacttgattcatccc-tatacagagaggcctcataaaacattgtcacctttgtgtgcaccataagtacacagtgca-------ttcaa |
37764871 |
T |
|
| Q |
101 |
taaagcggttatccatggttaaaccgcgattaatatcctcactactactagaatgaaacatgcacattataaatggtattcgaattccaaaatccaaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37764870 |
taaagcggttatccatggttaaaccgcgattaatatcctcacttctactagaatgaaacatgcacattataaatggtattcgaattccaaaatccaaaag |
37764771 |
T |
|
| Q |
201 |
taaaaaagttatttttgcagttttaaggaggcgcaagaaacatgaaagttgagataaaaaatttccataatcatactggcagaattttggacttctgctc |
300 |
Q |
| |
|
|| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37764770 |
tatataagttatttttgcagttttaaggaggcgcaagaaacatgaaagttgagataagaaatttccataatcatactggcagaattttggatttctgctc |
37764671 |
T |
|
| Q |
301 |
tcccccagcacaaaa |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37764670 |
tcccccagcacaaaa |
37764656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University