View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20817_low_16 (Length: 392)
Name: NF20817_low_16
Description: NF20817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20817_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 9 - 319
Target Start/End: Original strand, 42453894 - 42454204
Alignment:
| Q |
9 |
atcataggtcaatcatatgcctccatctatgtgactcccactcttcatcttcgtcccaatgcataggtaacaacacacgcatatatctacagcttagacg |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42453894 |
atcataggtcaatcatatgcgtccatctctgtgactcccacttatcatcttcgtcccaatgcataggtaacaacacacgcatatatctacaacttagacg |
42453993 |
T |
|
| Q |
109 |
ttgtttcatttttggctagtgataaagccatatagggtaaaattatcatcaatgattgatgttttaagcgatagtgatccatccacgtgcaaccaataac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42453994 |
ttgtttcatttttggctagtgataaagccataaagggtaaaattatcatcaatgattgatattttaagcgatagtgatccatccacgtgcaatcaataac |
42454093 |
T |
|
| Q |
209 |
atgccagattgattgatagataaaattggcgcacaataatgaaccttatacaatagtgatccatcttctttaattagtatttataatcttcacaagttat |
308 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42454094 |
atgccagattgattgatagataatcttggagcacaataatgaaccttatacaatagtgatccatcttctttaattagtattaataatcttcacaagttat |
42454193 |
T |
|
| Q |
309 |
tgctttcttta |
319 |
Q |
| |
|
||||||||||| |
|
|
| T |
42454194 |
tgctttcttta |
42454204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 316 - 378
Target Start/End: Original strand, 42454276 - 42454338
Alignment:
| Q |
316 |
tttatgaacgttttcccctaaccagtttggaaatactaatagtatgtcattggttgttactaa |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42454276 |
tttatgaacgttttcccctaaccagtttggaaatactaatagtatgtcattggttgttactaa |
42454338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University