View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20817_low_23 (Length: 307)
Name: NF20817_low_23
Description: NF20817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20817_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 16 - 293
Target Start/End: Original strand, 36635824 - 36636101
Alignment:
| Q |
16 |
atggagcatggtgacgaaaccaatgaagccgagactcatcacgagaaccaccgtcggagaaatcttcaaaccaggtgcatcgtcagtgtagaatcgcagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36635824 |
atggagcatggtgacgaaaccaatgaagccgagactcatcacgagaaccaccgtcggagaaatcttcaaaccaggtgcatcgtcggtgtagaatcgcagc |
36635923 |
T |
 |
| Q |
116 |
atgttgttccctccgctggagcttcctgcggcagaggtggagctggtagtgtttccacctgttgggcggcgacgacgcataccggctgtagcggcagcgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36635924 |
atgttgttccctccgctggagcttcctgcggcagaggtggagctggtagtgtttccacctgttggacggcgacgacgcataccggctgtagcggcagcgg |
36636023 |
T |
 |
| Q |
216 |
agccgcgtggtgccatgacacctggtcgtgtcgtggcaccggaagatgcagattgagatgattgagaggcggttcttg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36636024 |
agccgcgtggtgccatgacacctggtcgtgtcgtggcaccggaagatgcagattgagatgattgagaggcggttcttg |
36636101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 25 - 132
Target Start/End: Complemental strand, 39998575 - 39998468
Alignment:
| Q |
25 |
ggtgacgaaaccaatgaagccgagactcatcacgagaaccaccgtcggagaaatcttcaaaccaggtgcatcgtcagtgtagaatcgcagcatgttgttc |
124 |
Q |
| |
|
|||||||||||||||||||| ||||||||| || | ||| ||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||| | |
|
|
| T |
39998575 |
ggtgacgaaaccaatgaagcagagactcataaccaaaacaaccgtaggagaaatcttcaaaccaggtgcatcatcagtgtagaatctcagcatgttgctt |
39998476 |
T |
 |
| Q |
125 |
cctccgct |
132 |
Q |
| |
|
|||||||| |
|
|
| T |
39998475 |
cctccgct |
39998468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 182 - 225
Target Start/End: Complemental strand, 39998424 - 39998381
Alignment:
| Q |
182 |
cggcgacgacgcataccggctgtagcggcagcggagccgcgtgg |
225 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
39998424 |
cggcgacgacgcatgccggcagtggcggcagcggagccgcgtgg |
39998381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University