View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20817_low_29 (Length: 248)
Name: NF20817_low_29
Description: NF20817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20817_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 34 - 246
Target Start/End: Original strand, 15756676 - 15756888
Alignment:
| Q |
34 |
acttttttgatgatttgg-cacattttttacgatgtggcttacatatattggttaagtaacattttactcatttttacaattnnnnnnnttgcattatat |
132 |
Q |
| |
|
||||| |||||||||||| ||||||||| | |||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
15756676 |
actttcttgatgatttgggcacatttttgatgatgtggcgtacatatattggttaagtaacatttgactcatttttacaat-aaaaaaattgcattatat |
15756774 |
T |
|
| Q |
133 |
caaaatataattgtttaannnnnnnctcatattttgtagacataaaatattttaattaaaacatcaaaccctaaaatgtatgccctt-tttaatcttcat |
231 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
15756775 |
caaaatataattgtttaacttttt-ctcatattttatagacataaaatattttaattaaaacatcaaaccctaaaaagtattcccttctttaatcttcat |
15756873 |
T |
|
| Q |
232 |
cttcgacaccaaatt |
246 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
15756874 |
cttcaacaccaaatt |
15756888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 17 - 97
Target Start/End: Original strand, 15756544 - 15756624
Alignment:
| Q |
17 |
aaaataccatggaagctacttttttgatgatttggcacattttttacgatgtggcttacatatattggttaagtaacattt |
97 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15756544 |
aaaataccattggagttacttttttgatgatttggcacattttttacgatgtggcgtacatatattggttaagtaacattt |
15756624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University