View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20817_low_36 (Length: 217)
Name: NF20817_low_36
Description: NF20817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20817_low_36 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 69034 - 68829
Alignment:
| Q |
1 |
tactcacaccccctgtctctgctttcaacaccacactccttgctttcttaccaataccaaaggaaccagtgttgaaattggtacccataattcccttttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
69034 |
tactcacaccccctgtctctgctttcaccaccacactccttgctttcttaccaataccaaaggaaccagtgttgaaattggtacctgtaattccattttt |
68935 |
T |
 |
| Q |
101 |
tctctcacttaaacatggcttttggcacaaaactacaccagcttggcttaaaacagatgccattgaaaagggtgtctttgattttgg--ttgtgtttatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
68934 |
tctctcacttaaacatggcttttggcacaaaactacaccaacttggcttaaaacagatgccattgaaaagggtgtctttgaatttggttttgtgtttatc |
68835 |
T |
 |
| Q |
199 |
ttctct |
204 |
Q |
| |
|
|||||| |
|
|
| T |
68834 |
ttctct |
68829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University