View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20817_low_37 (Length: 215)

Name: NF20817_low_37
Description: NF20817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20817_low_37
NF20817_low_37
[»] chr1 (1 HSPs)
chr1 (1-204)||(37765723-37765934)


Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 37765934 - 37765723
Alignment:
1 atggaaattgaaatctgacctgggaaccatgtctttgtgcnnnnnnngtcaaacaatgtaaaggcatgaatgagtgtttgttacttcatgcggtttagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||| ||||||||||||||||||||||    
37765934 atggaaattgaaatctgacctgggaaccatgtctttgtgctttttttgtcaaacaatgtaaaggcatgaatgagtgtatgttacttcatgcggtttagaa 37765835  T
101 gattaatcggtttgaattaatggat--------taaaaagttagagatccatttaaatctagactaagaataacaaaataataatcaaataaatataatt 192  Q
    ||||||| |||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37765834 gattaataggtttgaattaatggattaaagaattaaaaagttagagatccatttaaatctagactaagaataacaaaataataatcaaataaatataatt 37765735  T
193 gtatctttagca 204  Q
    ||||||||||||    
37765734 gtatctttagca 37765723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University