View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20818_low_1 (Length: 272)
Name: NF20818_low_1
Description: NF20818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20818_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 17 - 257
Target Start/End: Complemental strand, 26582796 - 26582556
Alignment:
| Q |
17 |
acctgtggtttatgtaccgatgaagaattccctcccctgcaactgttacggccatatatatcactctactacaggtggctgtaggagcctttgtacttag |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26582796 |
acctctggtttatgtaccgatgaagaattccctccactgcaactgttacggccatatatatcactctactacagatggctgtaggagcctttgtacttag |
26582697 |
T |
 |
| Q |
117 |
tactagctagctatattttttgaaccctagacttaggtttttgtcaagctgtgattatgcaaacaatccattagttataagctataatagcttgtatatg |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26582696 |
tactagctagctatatttttttaaccctagacttaggtttttgtcaagctgtgattatgcaaacaatccattagttataagctataatagcttgtatatg |
26582597 |
T |
 |
| Q |
217 |
gtagacaatttccaagattgtaaaggtgttaagtggttagt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26582596 |
gtagacaatttccaagattgtaaaggtgttaagtgattagt |
26582556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University