View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2081_low_3 (Length: 260)
Name: NF2081_low_3
Description: NF2081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2081_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 153 - 241
Target Start/End: Original strand, 2367704 - 2367792
Alignment:
| Q |
153 |
aataaccagatttggtaattaacccaactaacccattcatgcatgcttttctttatttaaataaataaccagtattaaatatgccaaat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2367704 |
aataaccagatttggtaattaacccaactaacccattcatgcatgcttttctttatttaaataaataaccagtattaaatatgccaaat |
2367792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University