View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_high_31 (Length: 341)
Name: NF20821_high_31
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 191 - 325
Target Start/End: Complemental strand, 2939418 - 2939284
Alignment:
| Q |
191 |
gaatcgtatatgtaacattagaatagcatactcaaatttgtctaggttttgttgatcctaagtatattcaaacgttgcatgcaattatatataggctata |
290 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939418 |
gaatcgtatatgtaacattagaatagcattctcaaatttgtctaggttttgttgatcctaagtatattcaaacgttgcatgcaattatatataggctata |
2939319 |
T |
 |
| Q |
291 |
gccattgaaggagttctatttcgatctcttgaagt |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939318 |
gccattgaaggagttctatttcgatctcttgaagt |
2939284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 52 - 125
Target Start/End: Complemental strand, 2939557 - 2939484
Alignment:
| Q |
52 |
tacaaaaccgccgatattggatccattcatcgatcaacactcaaggttttgtcacgatcattagggttagtacc |
125 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939557 |
tacagaaccgccgatattggatccattcatcgatcaacactcaaggttttgtcacgatcattagggttagtacc |
2939484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University