View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_high_32 (Length: 336)
Name: NF20821_high_32
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 17 - 326
Target Start/End: Original strand, 1391011 - 1391320
Alignment:
| Q |
17 |
caacaaaatctgtaaatagatgaattggtccctatttgtgagcatttttgtcaaaatagtccctgaaatatgctatttgacaaataaatccataaaatgt |
116 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1391011 |
caacaaaatgagtaaatagatgaattggtccctaatcgtgagcatttttgtcaaaatagtccctgaaatatgctatttgacaaataaatccataaactgt |
1391110 |
T |
 |
| Q |
117 |
aacacatcagtcagaatggtctcactgttagtttattcctcgagatactatgatgcggcgcgttcattgagcatgtagcattccacctggatgaccaaat |
216 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1391111 |
aacacatcaatcagaatggtctcactgttagtttattcctcgagatactatgatgtggcgcgttcattgagcatgtagcattccacctggatgaccacat |
1391210 |
T |
 |
| Q |
217 |
gttcgtttagcgcatcagatcatagccttccgcatcagagatcatttgccgatttgtacaatttagagactatttggaccgttgtttacaattttgagga |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1391211 |
gttcgtttagcgcatcagatcatagccttccacatcagagatcatttgccgatttgtacaatttagagactatttggaccgttgtttacaattttgaaga |
1391310 |
T |
 |
| Q |
317 |
acatattctt |
326 |
Q |
| |
|
|||||||||| |
|
|
| T |
1391311 |
acatattctt |
1391320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University