View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_high_43 (Length: 290)
Name: NF20821_high_43
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 394668 - 394940
Alignment:
| Q |
1 |
tactatcaccatagctacgatccgtggtttaagcaactgttcaccgcaaccgaagaggagaaatcaattgtaccaccgtatctgaaacgatccggttgag |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
394668 |
tactatcaccatagctacgatccttggtttaagcaactgttcaccacaaccaaagaggagaac-caattgtaccaccgtatctgaaacgatccggttgag |
394766 |
T |
|
| Q |
101 |
gatttcggtgaaggtggagctttcccggaaatccacgtgatacagtatccgcttgatatggaaaggaatgagaattcgaagagattcttacggttacggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394767 |
gatttcggtgaaggtggagctttcccggaaatccacgtgatacagtatccacttgatatggaaaggaatgagaattcgaagagattcttacggttacggt |
394866 |
T |
|
| Q |
201 |
tgatgttcatggtaatgttgcgtgtgatgctatgagaatgcgaagaaatttgtatatatccagcacaaggattt |
274 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
394867 |
tgatgttcatggtaatgttgcgtatgatgctatgagaatgcgaagaaatttgtatatacccagcacaaggattt |
394940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 94 - 233
Target Start/End: Complemental strand, 11456021 - 11455872
Alignment:
| Q |
94 |
ggttgaggatttcggtgaaggtggagctttcccggaaatccacgtgatacagtatccgcttgatatggaaaggaatgagaattcgaag----------ag |
183 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||| ||| |||||||||||||||||||| ||||||| ||||||||||| || |
|
|
| T |
11456021 |
ggttgaggattttggagaaggtggagctttcccggagatccatgtggcacagtatccgcttgatatgggaaggaataagaattcgaagccgggttcgaag |
11455922 |
T |
|
| Q |
184 |
attcttacggttacggttgatgttcatggtaatgttgcgtgtgatgctat |
233 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| | ||||||||| |
|
|
| T |
11455921 |
attcttccggttacggttgatgctcatggtaatgttgcttatgatgctat |
11455872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 11456149 - 11456085
Alignment:
| Q |
1 |
tactatcaccatagctacgatccgtggtttaagcaactgttcaccgcaaccgaagaggagaaatc |
65 |
Q |
| |
|
|||||| | |||||| ||||||| |||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
11456149 |
tactatgatcatagcaacgatccatggtttaagcaaagattcactgcaacggaagaggagaaatc |
11456085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University