View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_high_46 (Length: 278)
Name: NF20821_high_46
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_high_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 54 - 204
Target Start/End: Complemental strand, 28570703 - 28570553
Alignment:
| Q |
54 |
catggaagttaatgatgaatctagataattggatgactagattactcaaagctaaatatttttcttgaagtgttagtcacaacccaagctaggtgtgtgg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
28570703 |
catggaagttaatgatgaatctagataattggatgactagattactcaaagctaaatatttttcttcaagtgttggtcacaacccaagctaggtgtgtgg |
28570604 |
T |
|
| Q |
154 |
agaagtatttggagtatgaaatttgttgtcagatgagggcacaaatggagt |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
28570603 |
agaagtatttggagtgtgaaatttgttgttagatgagggtacaaatggagt |
28570553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University