View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_high_55 (Length: 266)
Name: NF20821_high_55
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_high_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 28267225 - 28267472
Alignment:
| Q |
1 |
ataaaaggggggcatataagacaataaacaaggcgcgagtgcgcatattcgcggcgcagtcctcgcgataatttaaaagaagcgccattttt-attttcc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28267225 |
ataaaaggggggcatataagacaataaacaaggcgcgagtgcgcatattcgcggcgcagtcctcgcgataatttaaaagaagcgccattttttattttcc |
28267324 |
T |
 |
| Q |
100 |
nnnnnnnggaaaatgtacgatctacggcttgcgtaatcgcattaccacgcgtcagcaatgcaacggtgattgacacgaacttcaacatacgaatatcctt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28267325 |
aaaaaaaggaaaatgtacgatctacggcttgcgtaaacgcattaccacgcgtcagcaatgcaacggtgatcaacacgaacttcaacatacgaatatcctt |
28267424 |
T |
 |
| Q |
200 |
tccgaaatgtcaatcccttattggtccacgtggcatccctcttaaaac |
247 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
28267425 |
tccgaaatgtcaatctcttattggtccacgtggtatccctctaaaaac |
28267472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University