View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20821_high_74 (Length: 218)

Name: NF20821_high_74
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20821_high_74
NF20821_high_74
[»] chr2 (1 HSPs)
chr2 (1-218)||(786260-786477)
[»] chr4 (1 HSPs)
chr4 (1-47)||(8896688-8896734)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 786260 - 786477
Alignment:
1 ttgaattggatatagggaattcaagtaaagctactattactgttaatgctgatggcggtgaatcgaagtcggtggggaaagggaaagggaagcaactatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||    
786260 ttgaattggatatagggaattcaagtaaagctactattactgttaatgcagatggccgtgaatcgaagtcggtggggaaagggaaagggaagcaactatc 786359  T
101 aaagggatcgggtttgggttctaatgtaggcggtggttgtgtaaaggtgaaagggaatggagggccgatgtttaaggatttgggtggaatgaatggtata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
786360 aaagggatcgggtttgggttctaatgtaggcggtggttgtgttgaggtgaaagggaatggagggccgatgtttaaggatttgggtggaatgaatggtata 786459  T
201 ttggaggaattgatgatg 218  Q
    ||||||||||||||||||    
786460 ttggaggaattgatgatg 786477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 8896734 - 8896688
Alignment:
1 ttgaattggatatagggaattcaagtaaagctactattactgttaat 47  Q
    |||||||||||||||| |||||||||||||||||| |||||||||||    
8896734 ttgaattggatataggaaattcaagtaaagctactgttactgttaat 8896688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University