View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_high_78 (Length: 205)
Name: NF20821_high_78
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_high_78 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 14229111 - 14229219
Alignment:
| Q |
17 |
ataaagatagtctaatataaga----aaagtatggagtaattttgtgtggcctttgtgtgttttaacggtcataaagtctaatttctatgtatgttagag |
112 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||| | ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
14229111 |
ataaagatactctaatataagaaagaaaagtatggagtaattttgtgtggcctttttgtgttttgagggtcataaagtataatttctatgtaggttagag |
14229210 |
T |
 |
| Q |
113 |
ttctcaata |
121 |
Q |
| |
|
||||||||| |
|
|
| T |
14229211 |
ttctcaata |
14229219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 151 - 192
Target Start/End: Complemental strand, 47656581 - 47656540
Alignment:
| Q |
151 |
ctgcacgaacccacacgaacaagctttcaacacatctgtgct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47656581 |
ctgcacgaacccacacgaacaagctttcaacacatctgtgct |
47656540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 190
Target Start/End: Original strand, 11441818 - 11441855
Alignment:
| Q |
153 |
gcacgaacccacacgaacaagctttcaacacatctgtg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11441818 |
gcacgaacccacacgaacaagctttcaacacatctgtg |
11441855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University