View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_19 (Length: 423)
Name: NF20821_low_19
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 389; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 389; E-Value: 0
Query Start/End: Original strand, 3 - 407
Target Start/End: Original strand, 786317 - 786721
Alignment:
| Q |
3 |
gtgaatcgaagtcggtggggaaagggaaagggaagcaactatcaaagggatcgggtttgggttctaatgtaggcggtggttgtgtaaaggtgaaagggaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
786317 |
gtgaatcgaagtcggtggggaaagggaaagggaagcaactatcaaagggatcgggtttgggttctaatgtaggcggtggttgtgttgaggtgaaagggaa |
786416 |
T |
 |
| Q |
103 |
tggagggccgatgtttaaggatttgggtggaatgaatggtatattggaggaattgatgatggatattgtgtcattgattaatcctgagttgcctaagcat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
786417 |
tggagggccgatgtttaaggatttgggtggaatgaatggtatattggaggaattgatgatggatattgtgtcattgattaatcccgagttgcctaagcat |
786516 |
T |
 |
| Q |
203 |
ttaggagtgaaaccggtgactgggattttgttgcatggaccacctggttgtggaaagactagacttgctcatgctattgctaacgagaccggtcttcctt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786517 |
ttaggagtgaaaccggtgactgggattttgctgcatggaccacctggttgtggaaagactagacttgctcatgctattgctaacgagaccggtcttcctt |
786616 |
T |
 |
| Q |
303 |
ttcatcgtatttcggctaccgaggtggtttctggtgtctcaggtattgctgaaatcttccatttttgttactcttgggatatgttaatgtactagtgttt |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786617 |
ttcatcgtatttcggctaccgaggtggtttctggtgtctcaggtattgctgaaatcttccatttttgttactcttgggatatgttaatgtactagtgttt |
786716 |
T |
 |
| Q |
403 |
gtgtc |
407 |
Q |
| |
|
||||| |
|
|
| T |
786717 |
gtgtc |
786721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 7e-22; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 227 - 340
Target Start/End: Complemental strand, 7309283 - 7309170
Alignment:
| Q |
227 |
attttgttgcatggaccacctggttgtggaaagactagacttgctcatgctattgctaacgagaccggtcttccttttcatcgtatttcggctaccgagg |
326 |
Q |
| |
|
|||||| |||| ||||||||||||||||| || |||||||||||||||||||||||||| || || | ||||||||| ||| |||||| ||||| || | |
|
|
| T |
7309283 |
attttgctgcacggaccacctggttgtgggaaaactagacttgctcatgctattgctaatgaaactgaacttcctttttatcctatttctgctactgatg |
7309184 |
T |
 |
| Q |
327 |
tggtttctggtgtc |
340 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
7309183 |
ttgtttctggtgtc |
7309170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 227 - 285
Target Start/End: Complemental strand, 7299521 - 7299463
Alignment:
| Q |
227 |
attttgttgcatggaccacctggttgtggaaagactagacttgctcatgctattgctaa |
285 |
Q |
| |
|
|||||||| ||||| ||| ||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
7299521 |
attttgttacatgggccatctggttgtggaaaaactatgcttgcttatgctattgctaa |
7299463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University