View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_27 (Length: 356)
Name: NF20821_low_27
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 32 - 346
Target Start/End: Original strand, 40733996 - 40734309
Alignment:
| Q |
32 |
ggttcaactctcacccaagataatttcataggaacggccttggaaagcaccaagaatgccaactagctccccttctcaaaccaaattaatcacgtctttg |
131 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40733996 |
ggttcaactctcacctaggataatttcataggaacagccctggaaagcaccaagaatgccaactagctccccttctcaaaccaaattaatcacgtctttg |
40734095 |
T |
 |
| Q |
132 |
ataccacttattgcgaagtcttgataatactggaatcattacaaacaattaatgatgcgtnnnnnnnnctccgataccacatcttcatacaaaatattat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
40734096 |
ataccacttattgcgaagtcttgataatactggaatcattacaaacaattaatgatgcgt-aaaaaaactctgataccacatcttcatacaaaatattat |
40734194 |
T |
 |
| Q |
232 |
gacatagattatatgtgtttgttttttatatatcattcatttagcttgatcctttggactaacgtaagactaatcggtcacacttgaattccaacaccac |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40734195 |
gacatagattatatgtgtttgttttttatatatcattcatttagcttgatcctttgaactcacgtaagactaatcggtcacacttgaattccaacaccac |
40734294 |
T |
 |
| Q |
332 |
cattcctcacctttg |
346 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
40734295 |
catccctcacctttg |
40734309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University