View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_28 (Length: 345)
Name: NF20821_low_28
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 3245457 - 3245664
Alignment:
| Q |
1 |
ttaggtgtggatgaagatggtttaaatgactcattagggacaccatggttgtgctctccatcatatgttgcaacaaggatagacctatcatgtatgcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245457 |
ttaggtgtggatgaagatggtttaaatgactcattagggacaccatggctgtgctctccatcatatgttgcaacaaggatagacctatcatgtatgcatt |
3245556 |
T |
 |
| Q |
101 |
tttgcacctaaaaaattagtaaatgaaataaggttagaatctctttaaaccacaattttttcatagaatcattcataaaaacataaccttgtaacctttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245557 |
tttgcacctaaaaaattagtaaatgaagtaaggttagaatctctttaaaccacaattttttcatagaatcattcataaaaacataaccttgtaacctttc |
3245656 |
T |
 |
| Q |
201 |
tagaaatc |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
3245657 |
tagaaatc |
3245664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 269 - 345
Target Start/End: Original strand, 3245723 - 3245799
Alignment:
| Q |
269 |
ccttcttttttgctgggcaactaggagccatggagcacctaaagtaagctctaggagaagcattgtctttggtaacc |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245723 |
ccttcttttttgctgggcaactaggagccatggagcacctaaagtaagctctaggagaagcattgtctttggtaacc |
3245799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 42 - 74
Target Start/End: Original strand, 3258375 - 3258407
Alignment:
| Q |
42 |
accatggttgtgctctccatcatatgttgcaac |
74 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
3258375 |
accatggttgtgctctccttcatatgttgcaac |
3258407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University