View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_29 (Length: 345)
Name: NF20821_low_29
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 334
Target Start/End: Original strand, 17945693 - 17946026
Alignment:
| Q |
1 |
aatttatgtgctacagaagtttgacttattttttcagtttctttcttagctacattatcaattgatattcgagttcgaaaagattgacttgctttaccag |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17945693 |
aatttatgtgctacagaagtttgactgattttttcggtttctttcttagctacattatcaattgatatatgagttcgaaaagattgacttgctttaccag |
17945792 |
T |
|
| Q |
101 |
tccatacaagaatcccaaaatgatcgtttggtttcgccatttcttcttcagttggtttgtcagttaatatgtgagttccaaaaggttgttttggttttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17945793 |
tccatacaagaatcccaaaatgatcgtttggttttgccatttcttcttcagttggtttgtcaattaatatgtgagttccaaaaggttgttttggttttac |
17945892 |
T |
|
| Q |
201 |
actttctttttgttcccaccatatgttaattccaaaaggttgtcttgcttttgcacttgttttctcgagccatttgcgagttccaaaaaattgatttgct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17945893 |
actttctttttgttcccaccatatgttaattccaaaaggttgtcttgcttttgcacttgttttctcgagccatttgcgagttccaaaaaattgatttgct |
17945992 |
T |
|
| Q |
301 |
tttttgacctgtaaatgtccctttgattgtgatg |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
17945993 |
tttttgacctgtaaatgtccctttgattgtgatg |
17946026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University