View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_34 (Length: 329)
Name: NF20821_low_34
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 132 - 312
Target Start/End: Original strand, 52318412 - 52318592
Alignment:
| Q |
132 |
ttccactaatactagtatattaaaaacatatgttgcagcttagtttctctccggatacaagtataccagaaaaggaggctgcacttatagagaacaaggc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
52318412 |
ttccactaatactagtatattaaaaacatatgttgcagcttagtttctctcctgatacaagtatacctgaaaaggaggctgcacttattgagaacaaggc |
52318511 |
T |
|
| Q |
232 |
agtttcatcagcagtgttggagactatgatcggcgagcacgctgtttcccctgatcttaagcgctgtttggctgcaagatt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52318512 |
agtttcatcagcagtgttggagactatgatcggcgagcacgctgtttcccctgatcttaagcgctgtttggctgcaagatt |
52318592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 23 - 133
Target Start/End: Original strand, 52318279 - 52318389
Alignment:
| Q |
23 |
ttccacctggtgcctctgttttctacaggcaatcacctgatggaatattaggggttagtaataatgccaattaattctgtttcttaactattttaattga |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52318279 |
ttccacctggtgcctctgttttctacaggcaatcacctgatggaatattaggggttagttataatgccaattaattctgtttcttaactattttaattga |
52318378 |
T |
|
| Q |
123 |
gttttactgtt |
133 |
Q |
| |
|
| ||||||||| |
|
|
| T |
52318379 |
ggtttactgtt |
52318389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University