View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_37 (Length: 317)
Name: NF20821_low_37
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_37 |
 |  |
|
| [»] scaffold0391 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0391 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: scaffold0391
Description:
Target: scaffold0391; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 11 - 300
Target Start/End: Complemental strand, 16214 - 15925
Alignment:
| Q |
11 |
ttatactcttaaattcgatcccgtctaaactaaatttctgactccgtccctagcaacaaagacttcccatgctttggtattctccaacgtgacacttttt |
110 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16214 |
ttatactcttaaattcgatcccatctaaactaaatttctgactccgtccctagcaacgaagacttcccatgctttggtattctccaacgtgacacttttt |
16115 |
T |
 |
| Q |
111 |
gagccaacttgcttatctaacttggaacatccatagtgcagtatatcttaaaatgtaaattattggtagaagagcaactagtaaaagaataacgaaacgt |
210 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16114 |
gagccaactagcttaactaacttggaacatccatagtgcagtatatcttaaaatgtaaattattggtagaagagcaactagtaaaagaataacgaaacgt |
16015 |
T |
 |
| Q |
211 |
aaatagcaaacaatggaacaatagtttgtttgcacagatcggccaagtgtgctatagagttgctagttacgtatattacttgagtgaatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16014 |
aaatagcaaacaatggaacaatagtttgtttgcacagatcggccaagtgtgctatagagctgctagttacgtatattacttgagtgaatt |
15925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University