View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_42 (Length: 295)
Name: NF20821_low_42
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 44 - 276
Target Start/End: Original strand, 36703919 - 36704141
Alignment:
| Q |
44 |
tgtgcaaatagaaaggcatcacgtgcattcagttttgttatcaaatagtaccatgaatttgcactatcaaatgtatgnnnnnnnnnnnnnnnnnnnaact |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||| |
|
|
| T |
36703919 |
tgtgcaaatagaaaggcatcacgtgcattcagttttgttatcaaatagtactatgaatttgcactatcaaatg-atgttttttttt----------aact |
36704007 |
T |
 |
| Q |
144 |
tctttcgcttattatctcatgtaagaataacacaaaa-taatggttgtttaaaaatagtaaaccgcaatgaaagtgtgaggttagtgaaaaatggagaaa |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36704008 |
tctttcgcttattatctcatgtaagaataacacaaaaataatggttgtttaaaaatagtaaaccgcaatgaaagtgtgaggttagtgaaaaatggagaaa |
36704107 |
T |
 |
| Q |
243 |
ttcaaccgatctatctaagttgaaaaaacaagac |
276 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||| |
|
|
| T |
36704108 |
ttcgaccgatatatctaagttgaaaaaacaagac |
36704141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University