View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_44 (Length: 284)
Name: NF20821_low_44
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 15 - 269
Target Start/End: Complemental strand, 786195 - 785941
Alignment:
| Q |
15 |
atcaaaagcaggttcaactttctcactataaattgcatcctctgaagtcgaaactgcaccttcatcatcatcagaagaatcttcttcagaggatgatgaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786195 |
atcaaaagcaggttcaactttctcactataaattgcatcctctgaagtcgaaactgcaccttcatcatcatcagaagaatcttcttcagaggatgatgaa |
786096 |
T |
 |
| Q |
115 |
acctgcgtgttcatcctcttttcaatgtgacgagcttccaatcttagcaatttttcttcagattcatcgatcatggcatccttacgtctctttcgagaag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786095 |
acctgcgtgttcatcctcttttcaatgtgacgagcttccaatctttgcaatttttcttcagattcatcgatcatggcatccttacgtctctttcgagaag |
785996 |
T |
 |
| Q |
215 |
aatttcgaacctcatcgtcggagtcggagtcgccgtcatccacggcggcattttt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785995 |
aatttcgaacctcatcgtcggagtcggagtcgccgtcatccacggcggcattttt |
785941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University