View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_45 (Length: 283)
Name: NF20821_low_45
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_45 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 72 - 283
Target Start/End: Original strand, 52318089 - 52318300
Alignment:
| Q |
72 |
taaattgataatgttttaggtccctttgaaaagttaattagagggtcaaagattagggaattgagtggtcctgagtactcaaggaaggttatggagaact |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52318089 |
taaattgataatgttttaggtccctttgaaaagttaattagagggtcaaagattagggaattgagtggtcctgagtactcaaggaaggttatggagaact |
52318188 |
T |
|
| Q |
172 |
gtgtagcacacttgaaatcagttggaacttatggagatgcagaagctgaagctatgcaaaaatttgctgaagctttcaagcctattaattttccacctgg |
271 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52318189 |
gtgtggcacacttgaaatcagttggaacttatggagatgcagaagctgaagctatgcaaaaatttgctgaagctttcaagcctattaattttccacctgg |
52318288 |
T |
|
| Q |
272 |
tgcctctgtttt |
283 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52318289 |
tgcctctgtttt |
52318300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University