View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20821_low_46 (Length: 278)

Name: NF20821_low_46
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20821_low_46
NF20821_low_46
[»] chr1 (1 HSPs)
chr1 (54-204)||(28570553-28570703)


Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 54 - 204
Target Start/End: Complemental strand, 28570703 - 28570553
Alignment:
54 catggaagttaatgatgaatctagataattggatgactagattactcaaagctaaatatttttcttgaagtgttagtcacaacccaagctaggtgtgtgg 153  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||    
28570703 catggaagttaatgatgaatctagataattggatgactagattactcaaagctaaatatttttcttcaagtgttggtcacaacccaagctaggtgtgtgg 28570604  T
154 agaagtatttggagtatgaaatttgttgtcagatgagggcacaaatggagt 204  Q
    ||||||||||||||| ||||||||||||| ||||||||| |||||||||||    
28570603 agaagtatttggagtgtgaaatttgttgttagatgagggtacaaatggagt 28570553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University