View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_60 (Length: 251)
Name: NF20821_low_60
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 27 - 233
Target Start/End: Complemental strand, 47836949 - 47836740
Alignment:
| Q |
27 |
gatttagatttgagttcatgaggatgattgagaaatagttgtgatgttgcggttaggtctcttccttttcttatggtagctaactcctctagcctttgac |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47836949 |
gatttagatttgagttcatgaggatgattgagaaatagttgtgatgttgcggttaggtctcttccttttcttatggtagctaactcctctagcctttgac |
47836850 |
T |
|
| Q |
127 |
tgaaaatcacgaacatcacgcaagtaaaacctaacagcaccatcaccaaaagggt---tacttccaccattgatctcttgatcatatgcggcgcggaggc |
223 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47836849 |
tggaaatcacgaacatcacgcaagtaaaacctaacagcaccatcaccaaaaggattactacttccaccattgatctcttgatcatatgcggcgcggaggc |
47836750 |
T |
|
| Q |
224 |
gaccgacaag |
233 |
Q |
| |
|
|||||||||| |
|
|
| T |
47836749 |
gaccgacaag |
47836740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 79 - 183
Target Start/End: Complemental strand, 35608910 - 35608806
Alignment:
| Q |
79 |
ttaggtctcttccttttcttatggtagctaactcctctagcctttgactgaaaatcacgaacatcacgcaagtaaaacctaacagcaccatcaccaaaag |
178 |
Q |
| |
|
||||| |||||||||||||| | |||||||| ||||||| |||| |||||||||||||| || | || |||| |||||||| || | |||||||| |
|
|
| T |
35608910 |
ttaggcctcttccttttcttttcatagctaacccctctagattttgcttgaaaatcacgaacgtcccttaaataaatcctaacagaacgagaaccaaaag |
35608811 |
T |
|
| Q |
179 |
ggtta |
183 |
Q |
| |
|
||||| |
|
|
| T |
35608810 |
ggtta |
35608806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University