View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_64 (Length: 249)
Name: NF20821_low_64
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 21 - 193
Target Start/End: Complemental strand, 2070198 - 2070025
Alignment:
| Q |
21 |
agtagctacatcgctgcaatttggtttgaaggggctggtggcggcgcctgtgagga-ggggaaaaagctgcgctgcaattcttctacaagcgactttgca |
119 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2070198 |
agtagctacatcgctgcaatttggattgaaggggctggtggcggcgcttgtgaggaaggggaaaaagctgcgctgcaattcttctacaagcgactttgca |
2070099 |
T |
 |
| Q |
120 |
tacttcgatacaaactcatcaaacaagggaataattgaatttgattctctgttaactgtcaaagttttctctaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2070098 |
tacttcgatacaaactcatcaaacaagggaataattgaatttgattctctgttaactgtcaaagttttctctaa |
2070025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 21 - 193
Target Start/End: Complemental strand, 2074544 - 2074371
Alignment:
| Q |
21 |
agtagctacatcgctgcaatttggtttgaaggggctggtggcggcgcctgtgagga-ggggaaaaagctgcgctgcaattcttctacaagcgactttgca |
119 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2074544 |
agtagctacatcgctgcaatttggattgaaggggctggtggcggcgctggtgaggaaggggaaaaagctgcgctgcaattcttctacaagcgactttgca |
2074445 |
T |
 |
| Q |
120 |
tacttcgatacaaactcatcaaacaagggaataattgaatttgattctctgttaactgtcaaagttttctctaa |
193 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2074444 |
tacttcgatacaaactcatcaaataagggaataattgaatttgattctctgttaactgtcaaagttttctctaa |
2074371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University