View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_67 (Length: 241)
Name: NF20821_low_67
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_67 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 241
Target Start/End: Original strand, 34792731 - 34792965
Alignment:
| Q |
7 |
agattatactgcttattagccactgtcagtcaatgagttcattctaatataaaactaccgatgttttatgaatcgtcatcttattatgttttgagccttt |
106 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
34792731 |
agattataatgctaattagccactgtcagtcaatgagttcattctaatataaaactaccgatgttttatgaatcgttatcttaatatgttttgagccttt |
34792830 |
T |
 |
| Q |
107 |
aattaggtgagattaaataaaccaatatttaaattgtcatcatgctatccggtgcgagggattaatctctacagttacgtgtatttgcacgaacaaattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||| ||||||||| |
|
|
| T |
34792831 |
aattaggtgagattaaataaaccaatatttaaattgtcatcatgctatccggtgcgagggattagtctctgcagttacgcgtatttgcacaaacaaattg |
34792930 |
T |
 |
| Q |
207 |
tcatcgggacatcgaaaaatattgatgtcgaggtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34792931 |
tcatcgggacatcgaaaaatattgatgtcgaggtg |
34792965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University