View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_70 (Length: 239)
Name: NF20821_low_70
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_70 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 106 - 223
Target Start/End: Complemental strand, 41827190 - 41827073
Alignment:
| Q |
106 |
tagcgatagtactttgcatcctcaccatactatgttttcttcttcatttcataatttaactttagtctttatacatattctcgtatcatatgttgtctca |
205 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41827190 |
tagcgatagtactttgcatccacaccataatatgttttcttcttcatttcataatttaactttagtctttatacatattctcgtatcatatgttgtctca |
41827091 |
T |
|
| Q |
206 |
cttttgaggccaacatat |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41827090 |
cttttgaggccaacatat |
41827073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 41827234 - 41827204
Alignment:
| Q |
1 |
aaagtctatttttgaagatagtgctttcttt |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41827234 |
aaagtctatttttgaagatagtgctttcttt |
41827204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University