View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_72 (Length: 232)
Name: NF20821_low_72
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 4597300 - 4597104
Alignment:
| Q |
20 |
gaactgaacccaccaagtccaaccatacaattgtatgatcaaacatgactaagaggccacaaatatatcttttcggtgactcaatcactgaggaatcctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4597300 |
gaactgaacccaccaagtccaaccatacaattgtatgatcaaacatgactaagaggccacaaatatatctttttggtgactcaatcactgaggaatcctt |
4597201 |
T |
|
| Q |
120 |
tgatgttggaggatggggtgcttctcttgccaactttttctcacgcacggtaacatccattcttgctttcttttgctttaacaactcatattttcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4597200 |
tgatgttggaggatggggtgcttctctttccaactttttctcacgcacagtaacatccattcttgctttgttttgctttaacaactcatattttcat |
4597104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 172
Target Start/End: Complemental strand, 4587651 - 4587579
Alignment:
| Q |
100 |
tcaatcactgaggaatcctttgatgttggaggatggggtgcttctcttgccaactttttctcacgcacggtaa |
172 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||| ||||||||| |||||| || ||||||| |
|
|
| T |
4587651 |
tcaatcactgaagaatcctttggtgttggaggatggggtgcttcttttgccaactatttctctcgtacggtaa |
4587579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 87 - 171
Target Start/End: Complemental strand, 4602206 - 4602122
Alignment:
| Q |
87 |
tcttttcggtgactcaatcactgaggaatcctttgatgttggaggatggggtgcttctcttgccaactttttctcacgcacggta |
171 |
Q |
| |
|
|||||||||||| ||||||||||| || || || ||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
4602206 |
tcttttcggtgattcaatcactgaagattcattctctgttggaggatggggtgcttctcttgccaaccatttctctcgcacggta |
4602122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University