View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_74 (Length: 218)
Name: NF20821_low_74
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_74 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 786260 - 786477
Alignment:
| Q |
1 |
ttgaattggatatagggaattcaagtaaagctactattactgttaatgctgatggcggtgaatcgaagtcggtggggaaagggaaagggaagcaactatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786260 |
ttgaattggatatagggaattcaagtaaagctactattactgttaatgcagatggccgtgaatcgaagtcggtggggaaagggaaagggaagcaactatc |
786359 |
T |
 |
| Q |
101 |
aaagggatcgggtttgggttctaatgtaggcggtggttgtgtaaaggtgaaagggaatggagggccgatgtttaaggatttgggtggaatgaatggtata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786360 |
aaagggatcgggtttgggttctaatgtaggcggtggttgtgttgaggtgaaagggaatggagggccgatgtttaaggatttgggtggaatgaatggtata |
786459 |
T |
 |
| Q |
201 |
ttggaggaattgatgatg |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
786460 |
ttggaggaattgatgatg |
786477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 8896734 - 8896688
Alignment:
| Q |
1 |
ttgaattggatatagggaattcaagtaaagctactattactgttaat |
47 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
8896734 |
ttgaattggatataggaaattcaagtaaagctactgttactgttaat |
8896688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University