View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20821_low_79 (Length: 202)
Name: NF20821_low_79
Description: NF20821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20821_low_79 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 15 - 140
Target Start/End: Original strand, 37625020 - 37625145
Alignment:
| Q |
15 |
aatattgaatgagggaggctgctttaattttatatatgcaattattttgagcacatgcagtgtagttgcatctaatttttatcatccaccctgtaaacta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37625020 |
aatattgaatgagggaggctgctttaattttatatatgcaattattttgagcacatgcagtgtagttgcatctaatttttatcatccaccctgtaaacta |
37625119 |
T |
|
| Q |
115 |
tgaagaatatatgccatttctcttgc |
140 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37625120 |
tgaagaatatatgccatttctcttgc |
37625145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University