View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20822_high_15 (Length: 292)
Name: NF20822_high_15
Description: NF20822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20822_high_15 |
 |  |
|
| [»] scaffold0082 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0082 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 12 - 154
Target Start/End: Complemental strand, 28776 - 28634
Alignment:
| Q |
12 |
atcatcatgaaaattaattaaacacgtccgttacttaaataccagtaggctgtaaaagcagctccccctgaaagccgtatggatcctttcgctcgatcgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28776 |
atcatcatgaaaattaattaaacacgtccgttacttaaataccagtaggctgtaaaagcagctccccctgaaagccgtatggatcccttcgctcgatcgg |
28677 |
T |
 |
| Q |
112 |
caggctctcctccctacagagttgcttctgttagaagagaaga |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28676 |
caggctctcctccctacagagttgcttctgttcgaagagaaga |
28634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 154 - 274
Target Start/End: Complemental strand, 6101620 - 6101500
Alignment:
| Q |
154 |
attatattataaaacagttgctgcgaaaaaagcgcaaaccaaaagttcatgattggctagaagaactacaagaattgagagagaccgcggatggtctgaa |
253 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||| | |||||||||| |
|
|
| T |
6101620 |
attatattataaaacaactgcagggaaaaaagcgcaaaccaaaagtttatgattagctagaagaactacaagaattgagagaaaccacatatggtctgaa |
6101521 |
T |
 |
| Q |
254 |
tacctcgatgacagttatgac |
274 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
6101520 |
tacctcaatgacagttatgac |
6101500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University