View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20822_high_18 (Length: 238)
Name: NF20822_high_18
Description: NF20822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20822_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 23 - 222
Target Start/End: Complemental strand, 34814979 - 34814780
Alignment:
| Q |
23 |
gatgaaccaaagataggtgagtagcatatcaatcacttgactgcttgtaaacaccaagattttcaataaagcttttcaataaacctacttgtaaacttgt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34814979 |
gatgaaccaaagataggtgagtagcatatcaatcacttgactgcttgtaaacaccaagattttcaataaagcttttcaataaacctacttgtaaacttgt |
34814880 |
T |
 |
| Q |
123 |
actaatttcacgtcaaatgcagttcatctaatttaagccatattttgattattttccatatgatgtgccctacttgaacatatctggcaattgaaaatat |
222 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34814879 |
actaatttcacctcaattgcagttcatctaatttaagccatattttgattattttccatatgatgtgccctacttgaacgtatctggcaattgaaaatat |
34814780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 35865221 - 35865154
Alignment:
| Q |
24 |
atgaaccaaagataggtgagtagcatatcaatcacttgactgcttgtaaacaccaagattttcaataa |
91 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
35865221 |
atgaaacaacgataggtgagtagcatatcaatcacttgactacgtgtaaacaccaatattttcaataa |
35865154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 167
Target Start/End: Complemental strand, 35865152 - 35865091
Alignment:
| Q |
106 |
cctacttgtaaacttgtactaatttcacgtcaaatgcagttcatctaatttaagccatattt |
167 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| |||| || || ||||||||||||||||| |
|
|
| T |
35865152 |
cctacttgtaaacttgtgctaatttcacctcagttgcatttaatttaatttaagccatattt |
35865091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University