View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20822_high_19 (Length: 221)
Name: NF20822_high_19
Description: NF20822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20822_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 3743846 - 3744026
Alignment:
| Q |
20 |
ataagtgacagactatcagcaacagcaactggctttacaaattcagttcatctacgtccaacttcgtcaagaccgtatatgacccacaacacaattgacc |
119 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3743846 |
ataagtaacagactaccagcaacagcaactggctttacaaattcagtttatctacgtccaacttcgtcaagaccgtatatgacccaca-----attgacc |
3743940 |
T |
 |
| Q |
120 |
cggactgttcatgcattttttgaaagggcgcaacgattttacacagatattctctgtataatgtaattttgagaatccccatatca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3743941 |
cggactgttcatgcattttttgaaagggcgcaacgattttacacatttattctctgtataatgtaattttgagaagccccatatca |
3744026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University