View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20822_low_15 (Length: 333)
Name: NF20822_low_15
Description: NF20822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20822_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 45346230 - 45346059
Alignment:
| Q |
1 |
gctcatgtttcttgtctttttctaacagtccatgtggaatcggttactcctttgaactcgatcaagaagcatctgaacggtgaaggaaaagttccgagta |
100 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346230 |
gctcatgtttcttgtctttttcttatagtccatgtggaatctgttactcctttgaactcgatcaagaagcatctgaacggtgaaggaaaagttccgagta |
45346131 |
T |
 |
| Q |
101 |
tcgtagctgttatcaaatcatgcactcctaacggttttggagacatgacggttaccctaaaggtcctgttct |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346130 |
tcgtagctgttatcaaatcatgcactcctaacggttttggagacatgacggttaccctaaaggtcctgttct |
45346059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 207 - 322
Target Start/End: Complemental strand, 45346019 - 45345904
Alignment:
| Q |
207 |
atgcttctgattcaagagtttgagtttcaggatcctacaggttcagttggtgctagtatccaccgcaaagtcttcactgaaggaggatttagaaaggata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346019 |
atgcttctgattcaagagtttgagtttcaggatcctacaggttcagttggtgctagtatccaccgcaaagtcttcactgaaggaggatttagaaaggata |
45345920 |
T |
 |
| Q |
307 |
taactgttggttctgt |
322 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45345919 |
taactgttggttctgt |
45345904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University